
To design your own oligonucleotide and see if it’s part of a real human gene.
You need...
Using the four basic nucleotides of the DNA chain (A, C, G, T) make up a DNA chain by randomly choosing about 20 or 30 units. AACTGCTTCGGATATCGCAGC for example. Now take the chain you made and point your Internet web browser to http://www.ncbi.nlm.nih.gov/BLAST. When you are there, click on Standard nucleotide-nucleotide BLAST which takes you to a page where you can paste in your sequence into the Search box. (e.g.: AACTGCTTCGGATATCGCAGC) Don't change any settings. Just click the BLAST button. A new page will come up and you click the Format button without changing anything. A new window opens and in a minute or two an automated system will show you the probable gene matches for that oligonucleotide if there are any.
If you get a match, you will see a list of possible proteins that your gene might code for. By clicking on items in this list you can find out more about the protein and it’s genetic code. Did you get a match? The string AACTGCTTCGGATATCGCAGC turns out to match an enzyme from a type of fungus. What protein does your gene represent? If your sequence was not part of a gene, try some other sequence until you find one.
Go back to activities list...

