objectif

Concevoir votre propre oligonucléotide et voir s’il se trouve vraiment dans un gène existant.

On a besoin de...
  • Crayon et papier
  • Un ordinateur connecté à Internet
  • Lisez-en plus au sujet de cette activité au biograph de Michael Smith...

    ce qui à faire

    En utilisant les quatre nucléotides de la chaîne d’ADN (A, C, G, T) constituez une chaîne en choisissant au hasard  20 à 30 unités environ, AACTGCTTCGGATATCGCAGC, par exemple. Maintenant prenez la chaîne que vous avez réalisée et à l'aide de votre navigateur Internet, allez sur le site www.ncbi.nlm.nih.gov/BLAST. Sur ce site, cherchez le titre  « Nucleotide, » et cliquez sur “Nucleotide-nucleotide BLAST (blastn)” qui vous emmènera à une page où vous pourrez entrer votre séquence dans le grand champ de recherche (« Search », en haut de l’écran). C’est là que vous devrez entrer AACTGCTTCGGATATCGCAGC, ou n’importe quel autre exemple crée de toutes pièces. Ne changez rien aux autres réglages de la page, mais cliquez sur le bouton « BLAST ». Une nouvelle page apparaît où vous cliquerez sur le bouton « Format »,  en ne changeant toujours rien aux réglages. Une nouvelle fenêtre s’ouvre et en une ou deux minutes un système automatique vous montrera les correspondances génétiques probables pour votre oligonucléotide imaginaire, si tout du moins elles existent. Soyez patient : cela pourra vous prendre plusieurs minutes si les ordinateurs de BLAST sont occupés.

        Si vous obtenez un résultat positif, vous verrez un ou plusieurs candidats possibles pour votre séquence. Le résultat de BLAST contient de nombreuses informations, comme le nombre de nucléotides correspondants, le noms des organismes où la séquence a été trouvée, les séquences des nucléotides environnants, les chercheurs qui l’on décodé pour la première fois etc. En cliquant sur les différents sujets de ce rapport vous arriverez sur différentes pages qui vous donnerons beaucoup plus de détails sur l'organisme dont le code génétique correspond à votre séquence. Il arrive parfois que votre séquence corresponde à un gène codant une protéine particulière.

    Avez-vous obtenu une correspondance? La séquence AACTGCTTCGGATATCGCAGC correspond en fait à une protéine qui se trouve dans un type de bactérie particulier appelée Bradyrhizobium japonicum, vivant sur les racines des plantes. Cette séquence correspond aussi au gène trouvé dans un champignon, une enzyme qui décompose la cellulose. À quel gène, protéine ou créature correspond votre propre séquence ? Si votre séquence ne faisait partie d’aucun gène connu, essayez-en une autre jusqu’à ce que vous en trouviez une.



    Retournez à la liste d'activités...